View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1613_high_11 (Length: 246)
Name: NF1613_high_11
Description: NF1613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1613_high_11 |
| |
|
Alignment Details
Target: chr4 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 4 - 232
Target Start/End: Complemental strand, 40063866 - 40063637
Alignment:
Q |
4 |
aataattgttttaagagaacaaaaatcataatccaatacatgtccttattattaa-taaataataatgtcaactataaaattcttttcattttatgtata |
102 |
Q |
|
|
||||||| |||||||| ||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||| |
|
|
T |
40063866 |
aataatttttttaagataacaaaaatcataatccaatagatgtccttattattaaataaataataatgtcaactataaaattcttttcatttattgtata |
40063767 |
T |
|
Q |
103 |
tttggagtgatattttgcctctattttgacattcatataactaatgacacatcatcaaagcaaagttagtaccaattccaaccccagcctgcagatgagt |
202 |
Q |
|
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40063766 |
ttttgagtgatattttgcctctattttgacattcatataactaatgacacatcatcaaagcaaagttagtaccaattccaaccccagcctgcagatgagt |
40063667 |
T |
|
Q |
203 |
gagttttgccaaactagcacgcctcaatat |
232 |
Q |
|
|
|||||||||||||||||||||||||||||| |
|
|
T |
40063666 |
gagttttgccaaactagcacgcctcaatat |
40063637 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 15863 times since January 2019
Visitors: 3757