View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1613_low_14 (Length: 316)
Name: NF1613_low_14
Description: NF1613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1613_low_14 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 304; Significance: 1e-171; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 304; E-Value: 1e-171
Query Start/End: Original strand, 1 - 316
Target Start/End: Original strand, 8188098 - 8188413
Alignment:
| Q |
1 |
gagaagaggaatgacttgattagtggtactagtgatggttttaggatagaagacataagcaacacaacgaaaccccgaagcccagtgatagacatagata |
100 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8188098 |
gagaagaagaatgacttgattagtggtactagtgatggttttaggatagaagacataagcaacacaacgaaaccccgaagcccagtgatagacatagata |
8188197 |
T |
|
| Q |
101 |
ctgaggatgctatttgtatgcgtactagagctcgttattcgcttgaaggtttcagtcttgatgagcttgagacctttcttcaagagaccgatgatgaaga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
8188198 |
ctgaggatgctatttgtatgcgtactagagctcgttattcgcttgaaggtttcagtcttgatgagcttgagacctttcttcaagagactgatgatgaaga |
8188297 |
T |
|
| Q |
201 |
tgatgttcaaaatgtcgatgatgaagaagagtataaaaaatttctagcagctgtattacagggtggagaacgtgacggtctttcatctcatgaaaatgaa |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8188298 |
tgatgttcaaaatgtcgatgatgaagaagagtataaaaaatttctagcagctgtattacagggtggagaacgtgacggtctttcatctcatgaaaatgaa |
8188397 |
T |
|
| Q |
301 |
aaccttgatggtgatg |
316 |
Q |
| |
|
|||||||||| ||||| |
|
|
| T |
8188398 |
aaccttgatgatgatg |
8188413 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 11237 times since January 2019
Visitors: 8059