View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1613_low_18 (Length: 238)
Name: NF1613_low_18
Description: NF1613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1613_low_18 |
| |
|
[»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 23 - 238
Target Start/End: Original strand, 5517208 - 5517426
Alignment:
Q |
23 |
aatagctagcaaaaaactagagtttttatagaaaagttcaaagttcaaaacctagctaaagctagcctggcattattccaattggtatgttaaatacttg |
122 |
Q |
|
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
5517208 |
aataactagcaaaaaactagagtttttatagaaaagttcaaagttcaaaacctagctaaagctagcctggcattattccaattggtatgttaaatactta |
5517307 |
T |
|
Q |
123 |
ggacaactcaaattaaaac---tgaatatactaaattacaatcaagtgactaaagaaaaaacaatgccagggaactggttggtatggactacaatgattg |
219 |
Q |
|
|
||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
T |
5517308 |
ggacagctcaaattaaaacacatgaatatactaaattacaatcaagtgactaaagaaaaaacaatgccagggaaccggttggtatggactacaatgattg |
5517407 |
T |
|
Q |
220 |
aacgtggccatcctgttgc |
238 |
Q |
|
|
||||||||||| ||||||| |
|
|
T |
5517408 |
aacgtggccattctgttgc |
5517426 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 14873 times since January 2019
Visitors: 8422