View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1613_low_19 (Length: 237)
Name: NF1613_low_19
Description: NF1613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1613_low_19 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 7077451 - 7077671
Alignment:
| Q |
1 |
cctactgatgtaaaggcataactaaaattaattgttagtaaatatagcggaaacccaaaccttcagatgttaagcaaccaaaaccttacagttttgcttt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
7077451 |
cctactgatgtaaaggcataactaaaattaattgttagtaaatatagcggaaacccaaaccttcagatgttaagcaaccaaaaccttgcagttttgcttt |
7077550 |
T |
|
| Q |
101 |
aaaattaagcttcgtggctctc--ctacatcaccaaaccatagtctcgtctagtttccctcgttattggttgaaaaggtttaaacccatttaataatttg |
198 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
7077551 |
aaaattaagcttcgtggctctcctctacatcaccaaaccttagtctcgtctagtttccctcgttattggttgaaaaggtttaaactcatttaataatttg |
7077650 |
T |
|
| Q |
199 |
aatatccttaaattagtgaat |
219 |
Q |
| |
|
||||| ||| ||| ||||||| |
|
|
| T |
7077651 |
aatatactttaatgagtgaat |
7077671 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 10233 times since January 2019
Visitors: 7975