View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1613_low_21 (Length: 230)
Name: NF1613_low_21
Description: NF1613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1613_low_21 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 26 - 216
Target Start/End: Complemental strand, 4274629 - 4274439
Alignment:
| Q |
26 |
ttttgatattgtggcaatccattactatccttaatgttacgattgtcatttcaaagatctttaaatttaccgacgaatgttggttcaagtggcaagaaag |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4274629 |
ttttgatattgtggcaatccattactatccttaatgttacgattgtcatttcaaagatctttaaatttaccgacgaatgttggttcaagtggcaagaaag |
4274530 |
T |
|
| Q |
126 |
tttggtgctcctaagtacgatatgaggttgagtcttgtaaatggaaaaatttatgttattccctttattcttatctactgactcagttcat |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4274529 |
tttggtgctcctaagtacgatatgaggttgaatcttgtaaatggaaaaatttatgttattccctttattcttatctactgactcagttcat |
4274439 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 10181 times since January 2019
Visitors: 7975