View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1624_high_35 (Length: 273)
Name: NF1624_high_35
Description: NF1624
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1624_high_35 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 1 - 273
Target Start/End: Original strand, 4135229 - 4135501
Alignment:
| Q |
1 |
agctaacaaaggagcgaattgagggagtccacgtggagcacatcgagatatctgggttgccgatgttgaacactgatcttgaggtggatggcacgtatcc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
4135229 |
agctaacaaaggagcgaattgagggagtccacgtggagcacatcgagatatctgggttgccgatgttgaacactgatcatgaggtggatggcacgtatcc |
4135328 |
T |
|
| Q |
101 |
gacggaagcggaagtgttttgtcagaaggttctagaagctaattcatatgtctttgcttatcctgattacaactactccttcacgcgtatgtttatttcc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
4135329 |
gacggaagcggaagtgttttgtcagaaggttctagaagctaattcatatctctttgcttatcctgattacaactactccatcactcgtatgtttatttcc |
4135428 |
T |
|
| Q |
201 |
ttttaattgcctgtttaatttgcaaattcgtaagaatttagtgaaagtcgaattgatcagaagtaaaatagaa |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4135429 |
ttttaattgcctgtttaatttgcaaattcgtaaggatttagtgaaagtcgaattgatcagaagtaaaatagaa |
4135501 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 655 times since January 2019
Visitors: 8587