View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1624_high_55 (Length: 231)
Name: NF1624_high_55
Description: NF1624
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1624_high_55 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 6 - 231
Target Start/End: Original strand, 32530354 - 32530581
Alignment:
| Q |
6 |
aatttcctcatttattatctatatgacta--atattttgctcgttcggttaaaatgttcacatcttatcttaatcactcacgttttcaatgaattcagtg |
103 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
32530354 |
aatttcctcatttattatctatatgactataatattttgctcgttcggttaaaatgttcacatcttatcttaataactcacgttttcaatgaattcagtg |
32530453 |
T |
|
| Q |
104 |
aaatcttgatataaaatatttttctcatgatttgctttttataagtttatgaaatttagtaaaggtgttttaaactttatgcagatgatgattggcatga |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32530454 |
aaatcttgatataaaatatttttctcatgatttgctttttgtaagtttatgaaatttagtaaaggtgttttaaactttatgcagatgatgattggcatga |
32530553 |
T |
|
| Q |
204 |
aaaggccataccctttctccatggattt |
231 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
32530554 |
aaaggccataccctttctccatggattt |
32530581 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 159 times since January 2019
Visitors: 8646