View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1631-INSERTION-1 (Length: 275)
Name: NF1631-INSERTION-1
Description: NF1631
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1631-INSERTION-1 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 105; Significance: 2e-52; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 72 - 208
Target Start/End: Complemental strand, 49117741 - 49117605
Alignment:
| Q |
72 |
attggtttgtttgtcattcgtgatatacttcctatattcaatctttggtgtaaactgagtatcctccgcgtgcaattgcggagattaatcattcgaattt |
171 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||||||||||||| ||||||||||||||||| ||| |||||||||||||||||||||| ||| ||||| |
|
|
| T |
49117741 |
attggtttgtttgtcattcatgatatactttctatattcaatcttcggtgtaaactgagtatcatccacgtgcaattgcggagattaatccttcaaattt |
49117642 |
T |
|
| Q |
172 |
tacgggactttaatggacgacaaactctttcaaagag |
208 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||| |
|
|
| T |
49117641 |
tatgggactttaatggacgacaaactctttcaaagag |
49117605 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 229 - 258
Target Start/End: Complemental strand, 49117581 - 49117552
Alignment:
| Q |
229 |
aaatatgtaattgtgcctaaattttgtgac |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
49117581 |
aaatatgtaattgtgcctaaattttgtgac |
49117552 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 119 - 161
Target Start/End: Complemental strand, 28665253 - 28665211
Alignment:
| Q |
119 |
gtgtaaactgagtatcctccgcgtgcaattgcggagattaatc |
161 |
Q |
| |
|
|||||||||| ||||||||||||||||| |||||||| ||||| |
|
|
| T |
28665253 |
gtgtaaactgggtatcctccgcgtgcaactgcggagactaatc |
28665211 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 7904 times since January 2019
Visitors: 7737