View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1631-INSERTION-11 (Length: 438)
Name: NF1631-INSERTION-11
Description: NF1631
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1631-INSERTION-11 |
| |
|
Alignment Details
Target: chr5 (Bit Score: 373; Significance: 0; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 373; E-Value: 0
Query Start/End: Original strand, 8 - 435
Target Start/End: Original strand, 607798 - 608226
Alignment:
Q |
8 |
atgtatatacaagattgcttgttttatcttttgtgacattggctcgtgtgtgttgttgctcgttgcgtcgtcgcttttaaggcttgtaacttgttttgga |
107 |
Q |
|
|
||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
607798 |
atgtatatacaagattgcttgttctatcttttgtgacattgtctcgtgtgtgttgttgctcgttgcgtcgtcgcttttaaggcttgtaacttgttttgga |
607897 |
T |
|
Q |
108 |
gnnnnnnngtt-ggcatcatcatcgtctcctcatattcaacatatttgacaacgtgaaattagcgacgatctttcaccaaccaagcaatgtcattccttc |
206 |
Q |
|
|
| ||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
T |
607898 |
gtttttttgtttggcttcatcatcgtctcctcatattcaacatatttgacaacgtgaaattagcgacgattcttcaccaaccaagcaatgtcattccttc |
607997 |
T |
|
Q |
207 |
acacaaaccttaaatgatgtgattgatgttccttttagttccttttagcgagctcccaaaccttgtataaatggtgattcactattaattaaaaattccg |
306 |
Q |
|
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
607998 |
acacaagccttaaatgatgtgattgatgttccttttagttccttttagcgagctcccaaaccttgtataaatggtgattcactattaattaaaaattccg |
608097 |
T |
|
Q |
307 |
atgatttatatcaactagggttggtaaaacgcaagaacaaactacattgcaaagttacaatgcagaaggaggatacacttctaaaatcnaggacctttct |
406 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
T |
608098 |
atgatttatatcaactagggttggtaaaacgcaagaacaaactacattgcaaagttacaatgcagaaggaggatacacttctaaaatcgaggacctttct |
608197 |
T |
|
Q |
407 |
atccaaattagcaaacttggaagatgctt |
435 |
Q |
|
|
||||||||||||||||||||||||||||| |
|
|
T |
608198 |
atccaaattagcaaacttggaagatgctt |
608226 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 264 - 344
Target Start/End: Original strand, 7959219 - 7959299
Alignment:
Q |
264 |
aaaccttgtataaatggtgattcactattaattaaaaattccgatgatttatatcaactagggttggtaaaacgcaagaac |
344 |
Q |
|
|
|||| ||| ||||| ||||||||||| | |||||||| ||| || |||||||| ||| ||||||||| |||| ||||||| |
|
|
T |
7959219 |
aaactttgcataaagggtgattcactgtcaattaaaatttctgaagatttataccaagtagggttggaaaaatacaagaac |
7959299 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 10373 times since January 2019
Visitors: 7978