View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1631-INSERTION-3 (Length: 172)
Name: NF1631-INSERTION-3
Description: NF1631
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1631-INSERTION-3 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 147; Significance: 9e-78; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 147; E-Value: 9e-78
Query Start/End: Original strand, 8 - 169
Target Start/End: Original strand, 36096581 - 36096743
Alignment:
| Q |
8 |
aaaaatgctatacatatctggacagcaaaaaatagaa-ttttgagaggtctagctctatctcaatgacaaaaagtttgattttcaattgcagcttcaagt |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36096581 |
aaaaatgctatacatatctggacagcaaaaaatagaaattttgagaggtctagctctatctcaatgacaaaaagtttgattttcaattgcagcttcaagt |
36096680 |
T |
|
| Q |
107 |
ttcatatctgaaaagtattatctaacgaaaacagtcttgcgaactagagacttcatatctgaa |
169 |
Q |
| |
|
|||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||| |
|
|
| T |
36096681 |
ttcatatctgaaaagtattatctaacaaaaccagtcttgcgaactagagacttcatatctgaa |
36096743 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.00000000006
Query Start/End: Original strand, 107 - 157
Target Start/End: Original strand, 36096732 - 36096782
Alignment:
| Q |
107 |
ttcatatctgaaaagtattatctaacgaaaacagtcttgcgaactagagac |
157 |
Q |
| |
|
|||||||||||| ||||||||||||| ||| |||||||| ||||||||||| |
|
|
| T |
36096732 |
ttcatatctgaagagtattatctaacaaaaccagtcttgtgaactagagac |
36096782 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 16495 times since January 2019
Visitors: 3768