View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1631-INSERTION-5 (Length: 194)

Name: NF1631-INSERTION-5
Description: NF1631
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1631-INSERTION-5
NF1631-INSERTION-5
[»] chr6 (1 HSPs)
chr6 (8-194)||(4142690-4142870)


Alignment Details
Target: chr6 (Bit Score: 128; Significance: 2e-66; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 8 - 194
Target Start/End: Complemental strand, 4142870 - 4142690
Alignment:
8 gttactgctttcatggaatgaaagttgccgtggacgttcaagaacacccaacacctgcaccatctccatctctatctctttcagatacagtgaaatctag 107  Q
    ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||      ||||||||||| ||||||  |    
4142870 gttactgctttcacggaatgaaagttgccgtggacgttcaagaacacccaacacctgcaccatctccatctct------ttcagatacagcgaaatccgg 4142777  T
108 tggtggttctattttaccatcaatgtgtacatgctttgggattattgttgctaatgtggtttatgtgagtttgtttttagtggggat 194  Q
    ||||| ||||||||| |||||||||| |||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||    
4142776 tggtgattctattttgccatcaatgtatacatgctttgggattattgttgctaatgttgtttatgtgagtttggttttagtggggat 4142690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 9791 times since January 2019
Visitors: 7932