View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1631-INSERTION-5 (Length: 194)
Name: NF1631-INSERTION-5
Description: NF1631
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1631-INSERTION-5 |
| |
|
[»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 128; Significance: 2e-66; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 8 - 194
Target Start/End: Complemental strand, 4142870 - 4142690
Alignment:
Q |
8 |
gttactgctttcatggaatgaaagttgccgtggacgttcaagaacacccaacacctgcaccatctccatctctatctctttcagatacagtgaaatctag |
107 |
Q |
|
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||| | |
|
|
T |
4142870 |
gttactgctttcacggaatgaaagttgccgtggacgttcaagaacacccaacacctgcaccatctccatctct------ttcagatacagcgaaatccgg |
4142777 |
T |
|
Q |
108 |
tggtggttctattttaccatcaatgtgtacatgctttgggattattgttgctaatgtggtttatgtgagtttgtttttagtggggat |
194 |
Q |
|
|
||||| ||||||||| |||||||||| |||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||| |
|
|
T |
4142776 |
tggtgattctattttgccatcaatgtatacatgctttgggattattgttgctaatgttgtttatgtgagtttggttttagtggggat |
4142690 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 9791 times since January 2019
Visitors: 7932