View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1631-INSERTION-8 (Length: 145)
Name: NF1631-INSERTION-8
Description: NF1631
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1631-INSERTION-8 |
| |
|
[»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 134; Significance: 4e-70; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 134; E-Value: 4e-70
Query Start/End: Original strand, 8 - 145
Target Start/End: Original strand, 22796216 - 22796353
Alignment:
Q |
8 |
ggtgttattgacattgtcgtgcctggtgtccatgtctatgtcggtgctccgtatgtagtatgttattttccatttaccacagaaactaaggttaacttgt |
107 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
T |
22796216 |
ggtgttattgacattgtcgtgcctggtgtccatgtctatgtcggtgctccgtatgtagtatgttattttccatttaccacagaaacaaaggttaacttgt |
22796315 |
T |
|
Q |
108 |
ttcaattttccttttatgtttaatagggagaggtacag |
145 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| |
|
|
T |
22796316 |
ttcaattttccttttatgtttaatagggagaggtacag |
22796353 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 16320 times since January 2019
Visitors: 3768