View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1637-INSERTION-1 (Length: 400)
Name: NF1637-INSERTION-1
Description: NF1637
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1637-INSERTION-1 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 381; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 381; E-Value: 0
Query Start/End: Original strand, 8 - 400
Target Start/End: Original strand, 30355557 - 30355948
Alignment:
| Q |
8 |
gtcgacgggtggtttactctgtctctgacaattttatgtttgtcatatttaaaaccctctttgtaccggattttctcgtgatttagcaagttggttgcct |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30355557 |
gtcgacgggtggtttactctgtctctgacaattttatgtttgtcatatttaaaaccctctttgtaccggattttctcgtgatttagcaagttggttgcct |
30355656 |
T |
|
| Q |
108 |
agtcgtgatggagttatggatctagttatccaaaagggtatgtgaaacggatgttgtcatgtctagtgacgttctcgttcttagattctttgattttatt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30355657 |
agtcgtgatggagttatggatctagttatccaaaagggtatgtgaaacggatgttgtcatgtctagtgacgttctcgttcttagattctttgattttatt |
30355756 |
T |
|
| Q |
208 |
cagatttgttgtaatttacaagttttaggtttggcgtcttgatggcttaatgtgatttatcaaggggtttgttggtgtcatggtgcgtgaatcagtccat |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30355757 |
cagatttgttgtaatttacaagttttaggtttggcgtcttgatggcttaatgtgatttatcaaggggtttgttggtgtcatggtgcgtgaatcagtccat |
30355856 |
T |
|
| Q |
308 |
gttagcggccagttcattcctcgtagttcatatttgagatgtgaagagtaattgagagtgttatctatgacttgtcaatcaacttttatagag |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
30355857 |
gttagcggccagttcattcctcgtagttcata-ttgagatgtgaagagtaattgagagtgttatctatgactcgtcaatcaacttttatagag |
30355948 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 13605 times since January 2019
Visitors: 8302