View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1637_high_14 (Length: 312)
Name: NF1637_high_14
Description: NF1637
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1637_high_14 |
| |
|
Alignment Details
Target: chr2 (Bit Score: 280; Significance: 1e-157; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 9 - 296
Target Start/End: Original strand, 41308330 - 41308617
Alignment:
Q |
9 |
gagatgaacacacatagatattgaaatggaacagagtaattatgcaaaaggggtgttttattgggggtgttggaagaaaacaccatgttctttgcatgca |
108 |
Q |
|
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
41308330 |
gagaagaacacacatagatattgaaatggaacagagtaattatgcaaaaggggtgttttattgggggtgttggaagaaaacaccatgttctttgcatgca |
41308429 |
T |
|
Q |
109 |
acaaacactagtgaaagtgtgattagagagaaagaaggtacaaatcaagaacatgatttggaattaggtgttgatggaaaagatttgcttttgaaatcca |
208 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
41308430 |
acaaacactagtgaaagtgtgattagagagaaagaaggtacaaatcaagaacatgatttggaattaggtgttgatggaaaagatttgcttttgaaatcca |
41308529 |
T |
|
Q |
209 |
atggtgaagaaagtttggaagtggaattgatgaggttgcataatctccctggtccaccaaggtttttgttcacaatcacagaagaaac |
296 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
41308530 |
atggtgaagaaagtttggaagtagaattgatgaggttgcataatctccctggtccaccaaggtttttgttcacaatcacagaagaaac |
41308617 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 13689 times since January 2019
Visitors: 8302