View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1637_high_19 (Length: 242)
Name: NF1637_high_19
Description: NF1637
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1637_high_19 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 11 - 225
Target Start/End: Complemental strand, 24157420 - 24157206
Alignment:
| Q |
11 |
cagagaaatggttgaagctgagattaagagagatttctagtgaaggaattagactcaattcctttggaatttctcctgtgaaactattgcttccaaggtc |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24157420 |
cagagaaatggttgaagctgagattaagagagatttctagtgaaggaattagactcaattcctttggaatttctcctgtgaaactattgcttccaaggtc |
24157321 |
T |
|
| Q |
111 |
tagaagctgtagtttagagcaagataagatctccgatggaattcttccgcttagtcgattctttcctaagtttagtttatttagctcgactaatgaacct |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
24157320 |
tagaagctgtagtttagagcaagataagatctccgatggaattcttccacttagtcgattctttcctaagtttagtttgcttagctcgactaatgaacct |
24157221 |
T |
|
| Q |
211 |
attgtgtgactcaat |
225 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
24157220 |
attgtgtgactcaat |
24157206 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 9584 times since January 2019
Visitors: 7931