View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1637_low_22 (Length: 218)
Name: NF1637_low_22
Description: NF1637
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1637_low_22 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 211
Target Start/End: Original strand, 53123530 - 53123740
Alignment:
| Q |
1 |
ccattttccagaatagttttgttttgtagtatccgggttggatttgaaccaagcaaatggttttcgtttgttaaagctgtttgcagtgtctttgaggcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53123530 |
ccattttccagaatagttttgttttgtagtatccgggttggattcgaaccaagcaaatggttttcgtttgttaaagctgtttgcagtgtctttgaggcaa |
53123629 |
T |
|
| Q |
101 |
tttttgggaagaatagatactgaacagcacaacgaaccaccaatgtgaaagattacagaaccaattagtccagtgactgttcctaaaactatgctgagaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53123630 |
tttttgggaagaatagatactgaacagcacaacgaaccaccaatgtgaaagattacagaaccaattagtccagtgactgttcctaaaactatgctgagaa |
53123729 |
T |
|
| Q |
201 |
taatctaccca |
211 |
Q |
| |
|
| |||| |||| |
|
|
| T |
53123730 |
tgatcttccca |
53123740 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 38 - 104
Target Start/End: Original strand, 6505046 - 6505112
Alignment:
| Q |
38 |
ttggatttgaaccaagcaaatggttttcgtttgttaaagctgtttgcagtgtctttgaggcaatttt |
104 |
Q |
| |
|
||||| |||||||||||| ||||||||| ||||| |||||| ||| |||||||||||||||||||| |
|
|
| T |
6505046 |
ttggacttgaaccaagcatatggttttcttttgtcaaagctacttggagtgtctttgaggcaatttt |
6505112 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 114 - 206
Target Start/End: Original strand, 6505155 - 6505246
Alignment:
| Q |
114 |
tagatactgaacagcacaacgaaccaccaatgtgaaagattacagaaccaattagtccagtgactgttcctaaaactatgctgagaataatct |
206 |
Q |
| |
|
||||||| |||| ||||||||| ||| |||| ||||| ||||||||||||| |||||| || | ||||||||||||||| | |||||||| |
|
|
| T |
6505155 |
tagataccaaacaacacaacgaatcacgaatgc-aaagagaacagaaccaattaatccagtaacagctcctaaaactatgctaataataatct |
6505246 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 14186 times since January 2019
Visitors: 8375