View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1637_low_9 (Length: 388)
Name: NF1637_low_9
Description: NF1637
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1637_low_9 |
| |
|
Alignment Details
Target: chr5 (Bit Score: 349; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 349; E-Value: 0
Query Start/End: Original strand, 21 - 377
Target Start/End: Complemental strand, 13674087 - 13673731
Alignment:
Q |
21 |
aattgcttcctcgcccttcagtagttgcgcaacctttagtacagaaagaaacaaatcacgttccagacacaaacacatgtgtttacatttaatcaccttt |
120 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
T |
13674087 |
aattgcttcctcgcccttcagtagttgcgcaacctttagtacagaaagaaacaaatcacgttccagacacaaacacatgtgtttacatgtaatcaccttt |
13673988 |
T |
|
Q |
121 |
gcttacgtaaattattattagtgtaagtattgtgtccaatgtatgtgtcagcgcttcatagaaaaggatgcttattttcttacttgtttcatgaatggcc |
220 |
Q |
|
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
13673987 |
gcttacttaaattattattagtgtaagtattgtgtccaatgtatgtgtcagcgcttcatagaaaaggatgcttattttcttacttgtttcatgaatggcc |
13673888 |
T |
|
Q |
221 |
gcttggaggatgaatggtggacgcacaaggaagctgtcttcatggcacggttcatttcggtgggatcatatttctcttctaatctaggatctgctagctc |
320 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
13673887 |
gcttggaggatgaatggtggacgcacaaggaagctgtcttcatggcacggttcatttcggtgggatcatatttctcttctaatctaggatctgctagctc |
13673788 |
T |
|
Q |
321 |
ttggacattttttgagtcaagaagtggcttggcctgacaatagtagatcatgttcat |
377 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
13673787 |
ttggacattttttgagtcaagaagtggcttggcctgacaatagtagatcatgttcat |
13673731 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 13745 times since January 2019
Visitors: 8302