View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1647-INSERTION-3 (Length: 124)
Name: NF1647-INSERTION-3
Description: NF1647
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1647-INSERTION-3 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 97; Significance: 4e-48; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 97; E-Value: 4e-48
Query Start/End: Original strand, 7 - 124
Target Start/End: Original strand, 2692900 - 2693021
Alignment:
| Q |
7 |
accaatgatatttgtgtatcgaaaaaataaatatattccatgtggtggcatgtcattccgggttattatcttttatttcttaaactatct----atccat |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
2692900 |
accaatgatatttgtgtatcgaaaaaataaatatattccatgtggtggcatgtcattccgggttattatcttttatttcttaaactatctatccatccat |
2692999 |
T |
|
| Q |
103 |
tacgtgttattttttcctttaa |
124 |
Q |
| |
|
||| |||| ||||||||||||| |
|
|
| T |
2693000 |
tacatgttgttttttcctttaa |
2693021 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 23 - 92
Target Start/End: Original strand, 2684581 - 2684647
Alignment:
| Q |
23 |
tatcgaaaaaataaatatattccatgtggtggcatgtcattccgggttattatcttttatttcttaaact |
92 |
Q |
| |
|
||||||||||||| ||||||| | |||||||||||||||||||||| | ||||| ||||||||||||| |
|
|
| T |
2684581 |
tatcgaaaaaatagatatattgcttgtggtggcatgtcattccggg---taatcttctatttcttaaact |
2684647 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 12727 times since January 2019
Visitors: 8225