View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1647_low_4 (Length: 230)
Name: NF1647_low_4
Description: NF1647
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1647_low_4 |
| |
|
Alignment Details
Target: chr6 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 4 - 204
Target Start/End: Original strand, 2445995 - 2446195
Alignment:
Q |
4 |
tttttctctagctttaatttaagtgtaaaaactcaagtatttttaaaattaatctaattattgtaacacatccttaatattgtacatctgcctaaacatt |
103 |
Q |
|
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
T |
2445995 |
tttttctctagctttaatttaagtgtaaaaaatcaagtatttttaaaattaatctaattattgtaacacatccttaatatggtacatctgcctaaacatt |
2446094 |
T |
|
Q |
104 |
acatttccttctattgatattagagtctccttgatatatccacaaagcttgaagaaaaatatttaggtatagatatgactcattaacaaaattaattaca |
203 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2446095 |
acatttccttctattgatattagagtctccttgatatatccacgaaggttgaagaaaaatatttaggtatagatatgactcattaacaaaattaattaca |
2446194 |
T |
|
Q |
204 |
t |
204 |
Q |
|
|
| |
|
|
T |
2446195 |
t |
2446195 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 9220 times since January 2019
Visitors: 7893