View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1647_low_5 (Length: 203)
Name: NF1647_low_5
Description: NF1647
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1647_low_5 |
| |
|
Alignment Details
Target: chr8 (Bit Score: 151; Significance: 4e-80; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 19 - 189
Target Start/End: Original strand, 40001713 - 40001882
Alignment:
Q |
19 |
gcacagagagagatagaatgttggtttttgaagatttttaaaatggataattataggcacttgttgtgttaggtgagtttcgattttattatttttatac |
118 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
40001713 |
gcacagagagagatagaatgttggtttttgaagatttttaaa-tggataattataggcacttgttgggttaggtgagtttcgattttattatttttatac |
40001811 |
T |
|
Q |
119 |
aagtataaatttatatatgaatgtgttatatggtgacatgttttgtgtgctaaaaggacaatgaagcatat |
189 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
T |
40001812 |
aagtataaatttatatatgaatgtgttatatggtgacatgttttgtgtgctaaaaaaacaatgaagcatat |
40001882 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 12447 times since January 2019
Visitors: 8218