View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1647_low_6 (Length: 203)
Name: NF1647_low_6
Description: NF1647
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1647_low_6 |
| |
|
Alignment Details
Target: chr8 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 15 - 188
Target Start/End: Original strand, 37601389 - 37601559
Alignment:
Q |
15 |
aggcatattattggaagtccaattgtagtaattgtagtagtaacttgcaataaagggcatctaaaacccaatcatatttttcagcaaacctttgcgcgtt |
114 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
37601389 |
aggcatattattggaagtccaattgtagtaattgtag---taacttgcaataaagggcatctaaaacccaatcatatttttcagcaaacctttgcgcgtt |
37601485 |
T |
|
Q |
115 |
ggaatttggaaaccataaaatagatagatgcacgcaaacagctagtacaagtacaacaagaaacaaagaaaaat |
188 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
37601486 |
ggaatttggaaaccataaaatagatagatgcacgcaaacagctagtacaagtacaacaagaaacaaagaaaaat |
37601559 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 12105 times since January 2019
Visitors: 8179