View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1681-Insertion-12 (Length: 152)
Name: NF1681-Insertion-12
Description: NF1681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1681-Insertion-12 |
| |
|
[»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 145; Significance: 1e-76; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 145; E-Value: 1e-76
Query Start/End: Original strand, 8 - 152
Target Start/End: Original strand, 37145741 - 37145885
Alignment:
Q |
8 |
gcttggagcggcactcactgaaatttgagattcaattggtgtagtcaaatacatgataagaaagaaagtttagtgggtactccagaaaatagtaaagatg |
107 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
37145741 |
gcttggagcggcactcactgaaatttgagattcaattggtgtagtcaaatacatgataagaaagaaagtttagtgggtactccagaaaatagtaaagatg |
37145840 |
T |
|
Q |
108 |
aaaagatgtatcatgtacaaatttaccagtagaaaggccaaagag |
152 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
37145841 |
aaaagatgtatcatgtacaaatttaccagtagaaaggccaaagag |
37145885 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 13496 times since January 2019
Visitors: 8302