View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1681-Insertion-4 (Length: 223)
Name: NF1681-Insertion-4
Description: NF1681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1681-Insertion-4 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 9 - 223
Target Start/End: Original strand, 1881645 - 1881859
Alignment:
| Q |
9 |
tttttccgttcgaggctttgaaatttgtattctgttactgtttcattagtcagttacagtattgttagaagttgctactttgaacatagcgagttatgca |
108 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
1881645 |
ttttcccgttcgaggctttgaaatttgtattctgttactgtttcattagtcagttacagtattgttagaagttgctactttgaacatcgcgagttatgca |
1881744 |
T |
|
| Q |
109 |
ttgatctattagtttcttaatgtagaatgaggatttcaacgcatctcgattggatctcagtcactccagaagtgaagttaaagataggacgatatcaatg |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1881745 |
ttgatctattagtttcttaatgtagaatgaggatttcaacgtatctcgatttgatcttagtcactccagaagtgaagttaaagataggacgatatcaatg |
1881844 |
T |
|
| Q |
209 |
gcgttagtacacgat |
223 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
1881845 |
gcgttagtacacgat |
1881859 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 15877 times since January 2019
Visitors: 3757