View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1681-Insertion-6 (Length: 478)
Name: NF1681-Insertion-6
Description: NF1681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1681-Insertion-6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 200; Significance: 1e-109; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 151 - 473
Target Start/End: Original strand, 46407012 - 46407335
Alignment:
| Q |
151 |
cagccatttgagtcaannnnnnngtttgagagtaagtagaacactgaattttagaagcttacgtccactcctgagtttcagagaggaaatnnnnnnnnnn |
250 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46407012 |
cagccatttgagtcaatttttttgtttgagagtaagtagaacactgaattttagaagcttacgtccactcctgagtttcagagaggaaataaagaaaaag |
46407111 |
T |
|
| Q |
251 |
nnnnnnnnnnnntgattttggggggtgcgagagagaaagagcgttgggaggcagtaaatttcactttcaaacgttactactaactaaggtcagaaggat- |
349 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46407112 |
aaaaaggaaaagtgattttggggggtgcgaga----aagagcgttgggaggcagtaaatttcactttcaaacgttactactaactaaggtcagaaggatg |
46407207 |
T |
|
| Q |
350 |
----cgtgatatctgatttcagatatatgaaaaagtaaagcaatcaatcactggcaggtagcagacacgagttgtaggttcaaaattgcacgtggctttt |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
46407208 |
agatcgtgatatctgatttcagatatatgaaaaagtaaagcaatcaatcactggcaggtagcagacacgagttgtaggtttaaaattgcacgtggctttt |
46407307 |
T |
|
| Q |
446 |
cattcaccgcataatttgggacatagaa |
473 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
46407308 |
cattcaccgcataatttgggacatagaa |
46407335 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 5 - 98
Target Start/End: Original strand, 46406863 - 46406956
Alignment:
| Q |
5 |
acattttaagagggaaatacggtacaannnnnnnngatggaattatctgaatgattgtcctttaaaatatggcaataatttaaggttccaagac |
98 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46406863 |
acattttaagagggaaatacggtacaattttttttgatggaattatctgaatgattgtcctttaaaatatggcaataatttaaggttccaagac |
46406956 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 9021 times since January 2019
Visitors: 7893