View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1681_high_19 (Length: 362)
Name: NF1681_high_19
Description: NF1681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1681_high_19 |
| |
|
Alignment Details
Target: chr1 (Bit Score: 160; Significance: 3e-85; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 168 - 346
Target Start/End: Complemental strand, 3531000 - 3530821
Alignment:
Q |
168 |
gttttatggctatgttacaagaaaatttaaacaaaggtgcacatattgccatgtaccttttattttgataggtacaaaagtacagccaaaa-gaactttt |
266 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||| |||||||| |
|
|
T |
3531000 |
gttttatggctatgttacaagaaaatttaaacaaaggtgcacatattgtcatgtaccttttattttgataggtacaaaagtacaaccaaaaagaactttt |
3530901 |
T |
|
Q |
267 |
ttaaacaaaatttcattttcaaaagttatgaaatttttgttgaacttaccaaggtaagttgagatatatgaagtgatcat |
346 |
Q |
|
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3530900 |
ttaaataaaatttcattttcaaaagttatgaaatttttgttgaacttaccaaggtaagttgagatatatgaagtgatcat |
3530821 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 38 - 70
Target Start/End: Complemental strand, 3531130 - 3531098
Alignment:
Q |
38 |
aaggatgtttggttagatcgaattttctagtat |
70 |
Q |
|
|
||||||||||||||||||||||||||||||||| |
|
|
T |
3531130 |
aaggatgtttggttagatcgaattttctagtat |
3531098 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 8653 times since January 2019
Visitors: 7803