View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1681_high_39 (Length: 257)
Name: NF1681_high_39
Description: NF1681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1681_high_39 |
| |
|
[»] scaffold0018 (1 HSPs) |
| | |
|
Alignment Details
Target: chr1 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 16 - 248
Target Start/End: Original strand, 43813881 - 43814112
Alignment:
Q |
16 |
aaatctatcgagggaggattttgctatctattatgatcccacatgattctagtaattagactctgcagttccgtgcaaatgatacctaattcacacnnnn |
115 |
Q |
|
|
|||||||| |||||||| |||||||||| |||||||||||||||||||||||| ||||||||||||||||| | |||||||||||||||||||||| |
|
|
T |
43813881 |
aaatctattgagggagggttttgctatccattatgatcccacatgattctagtgattagactctgcagttctgcgcaaatgatacctaattcacacaaaa |
43813980 |
T |
|
Q |
116 |
nnngggacatagtcttttggaacaatgtgaatgtttgtgtgtaaattaaaatattcaaaagtcccacattggagtttatacacaacactagtgtttatat |
215 |
Q |
|
|
|| |||||||||||||||||| |||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
T |
43813981 |
aaagg-acatagtcttttggaacactgtggatgtttgtgtgtgaattaaaatattcaaaagtcccacattggagtttatacacaacacttgtgtttatat |
43814079 |
T |
|
Q |
216 |
agtggagctaggactttaaaggtgtccctttgc |
248 |
Q |
|
|
| |||||||||||||| || ||||||||||||| |
|
|
T |
43814080 |
actggagctaggacttcaagggtgtccctttgc |
43814112 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0018 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0018
Description:
Target: scaffold0018; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 146 - 216
Target Start/End: Original strand, 187146 - 187220
Alignment:
Q |
146 |
atgtttgtgtgtaaattaaaatattc--aaaagtcccacattgg--agtttatacacaacactagtgtttatata |
216 |
Q |
|
|
||||||||||||||||| ||| | || | ||||| |||||||| ||||||||||||| ||||||||||||||| |
|
|
T |
187146 |
atgtttgtgtgtaaattgaaaaaatcttagaagtctcacattggttagtttatacacaatactagtgtttatata |
187220 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 8468 times since January 2019
Visitors: 7803