View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1681_high_48 (Length: 241)
Name: NF1681_high_48
Description: NF1681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1681_high_48 |
| |
|
Alignment Details
Target: chr2 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 3014628 - 3014403
Alignment:
Q |
1 |
caatgtaacacaattctatgtgttatgatgttccttaatgtgtcctcatccaactttgaattatgataattttttactaatggagaggaaacaagaaggt |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3014628 |
caatgtaacacaattctatgtgttatgatgttccttaatgtgtcctcatccaactttgaattatgataattttttactaatggagaggaaacaagaaggt |
3014529 |
T |
|
Q |
101 |
gacaaaaggaaacaaaaaccgattgtcaccagcaaaagggtatgaagcaa-aaaagttgtttttctacttagggtagaggttcatgattaatgtgaaatg |
199 |
Q |
|
|
|||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3014528 |
gacaaaaggaaacaaaaaccaattgtcaccagcaaaagggtatgaagcaaaaaaagttgtttttctacttagggtagaggttcatgattaatgtgaaatg |
3014429 |
T |
|
Q |
200 |
gggaccagacaaataaactagacagt |
225 |
Q |
|
|
|||||||||||||||||||||||||| |
|
|
T |
3014428 |
gggaccagacaaataaactagacagt |
3014403 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 13067 times since January 2019
Visitors: 8270