View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1681_high_52 (Length: 238)
Name: NF1681_high_52
Description: NF1681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1681_high_52 |
| |
|
Alignment Details
Target: chr4 (Bit Score: 82; Significance: 7e-39; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 18 - 103
Target Start/End: Original strand, 4884055 - 4884140
Alignment:
Q |
18 |
gctgttaggtgaatggaattgagaatggagatttcatgtggatagaatttgggatcatggaatgtggtccattgcaaatgtctgta |
103 |
Q |
|
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
4884055 |
gctgttaggtgaatggaattgagaatggggatttcatgtggatagaatttgggatcatggaatgtggtccattgcaaatgtctgta |
4884140 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 18 - 106
Target Start/End: Original strand, 4905284 - 4905372
Alignment:
Q |
18 |
gctgttaggtgaatggaattgagaatggagatttcatgtggatagaatttgggatcatggaatgtggtccattgcaaatgtctgtacta |
106 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
T |
4905284 |
gctgttaggtgaatggaattgagaatggagatttcatgtggatagaatttgggatcatggaatgtggtccattgttaatgtctgtacta |
4905372 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 18 - 106
Target Start/End: Original strand, 4924550 - 4924638
Alignment:
Q |
18 |
gctgttaggtgaatggaattgagaatggagatttcatgtggatagaatttgggatcatggaatgtggtccattgcaaatgtctgtacta |
106 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||| |
|
|
T |
4924550 |
gctgttaggtgaatggaattgagaatggagatttcatgtggatagtatttgggatcatggaatgtggtccattgttaatgtctgtacta |
4924638 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 27 - 106
Target Start/End: Complemental strand, 4646295 - 4646216
Alignment:
Q |
27 |
tgaatggaattgagaatggagatttcatgtggatagaatttgggatcatggaatgtggtccattgcaaatgtctgtacta |
106 |
Q |
|
|
||||| ||||||||||| | |||||||||||| ||||||||||||||||||||||||||||| |||||||||||||| |
|
|
T |
4646295 |
tgaattgaattgagaatcggtgtttcatgtggattaaatttgggatcatggaatgtggtccattgtaaatgtctgtacta |
4646216 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 50; Significance: 9e-20; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 35 - 104
Target Start/End: Complemental strand, 13096229 - 13096160
Alignment:
Q |
35 |
attgagaatggagatttcatgtggatagaatttgggatcatggaatgtggtccattgcaaatgtctgtac |
104 |
Q |
|
|
||||||| |||| | ||||||||||||||||||||||||| ||| ||||||||||||||||||||||||| |
|
|
T |
13096229 |
attgagagtggatagttcatgtggatagaatttgggatcacggagtgtggtccattgcaaatgtctgtac |
13096160 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 35 - 78
Target Start/End: Complemental strand, 9112479 - 9112436
Alignment:
Q |
35 |
attgagaatggagatttcatgtggatagaatttgggatcatgga |
78 |
Q |
|
|
||||||| |||||||||||||||||||||||||| ||||||||| |
|
|
T |
9112479 |
attgagagtggagatttcatgtggatagaatttgtgatcatgga |
9112436 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 9199 times since January 2019
Visitors: 7893