View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1681_high_58 (Length: 234)
Name: NF1681_high_58
Description: NF1681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1681_high_58 |
| |
|
[»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 19 - 234
Target Start/End: Original strand, 49065425 - 49065640
Alignment:
Q |
19 |
atatggcatctctactaccactctatggtgctaacagtaatagtatgagaccactttcaatcaaggtgcactctattgttcaaaagccaattcataattt |
118 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
49065425 |
atatggcatctctactaccactctatggtgctaacagtaatagtatgagaccactttcaatcaaggtgcactctattgttcaaaagccaattcataattt |
49065524 |
T |
|
Q |
119 |
ttcatccaatggctttggaactgaaagcacttattatggatatcatggttggtcaagaccccttatgaatcaacaacctggaagaggaaagctactgatg |
218 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
T |
49065525 |
ttcatccaatggctttggaactgaaagcacttattatggatatcatggttggtcaagaccccttatgaatcaacaacctggaagaggaaagctgctgatg |
49065624 |
T |
|
Q |
219 |
caaactttccaggaaa |
234 |
Q |
|
|
|||||||| ||||||| |
|
|
T |
49065625 |
caaactttgcaggaaa |
49065640 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 11252 times since January 2019
Visitors: 8059