View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1681_high_68 (Length: 229)

Name: NF1681_high_68
Description: NF1681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1681_high_68
NF1681_high_68
[»] chr6 (1 HSPs)
chr6 (19-133)||(1432804-1432918)


Alignment Details
Target: chr6 (Bit Score: 90; Significance: 1e-43; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 19 - 133
Target Start/End: Complemental strand, 1432918 - 1432804
Alignment:
19 gagtttgatcactgacaaaaatggaatttcagaagaaaagnnnnnnngtgttgtgtaataggaaagatagaatctgtgtagaagctatgtcaagcaatca 118  Q
    ||||||||||||||||||||||||||||||||||||||||       ||||||||||||||||||||||||||||||| |||||||||||||||||||||    
1432918 gagtttgatcactgacaaaaatggaatttcagaagaaaagtttttttgtgttgtgtaataggaaagatagaatctgtgaagaagctatgtcaagcaatca 1432819  T
119 aaccaggtggaataa 133  Q
    |||||||||||||||    
1432818 aaccaggtggaataa 1432804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 16403 times since January 2019
Visitors: 3768