View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1681_high_70 (Length: 227)
Name: NF1681_high_70
Description: NF1681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1681_high_70 |
| |
|
Alignment Details
Target: chr3 (Bit Score: 84; Significance: 5e-40; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 105 - 223
Target Start/End: Complemental strand, 25392727 - 25392608
Alignment:
Q |
105 |
ctatccttttattccaacctcttagagcttgctttaatccatagagggctttccataattttaactctttagatttatga-ttttttaccttcaaatcct |
203 |
Q |
|
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||| |||||| ||||||||| | |
|
|
T |
25392727 |
ctatccttttattccaagctcttagagcttgctttaatccatagagggctttccataatttatactctttagatttctgattttttttacttcaaatcgt |
25392628 |
T |
|
Q |
204 |
agaggctgtgtcacaaaaac |
223 |
Q |
|
|
|||||||||||||||||||| |
|
|
T |
25392627 |
agaggctgtgtcacaaaaac |
25392608 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 10296 times since January 2019
Visitors: 7975