View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1681_high_70 (Length: 227)

Name: NF1681_high_70
Description: NF1681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1681_high_70
NF1681_high_70
[»] chr3 (1 HSPs)
chr3 (105-223)||(25392608-25392727)


Alignment Details
Target: chr3 (Bit Score: 84; Significance: 5e-40; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 105 - 223
Target Start/End: Complemental strand, 25392727 - 25392608
Alignment:
105 ctatccttttattccaacctcttagagcttgctttaatccatagagggctttccataattttaactctttagatttatga-ttttttaccttcaaatcct 203  Q
    ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||  ||||||||||||| ||| ||||||  ||||||||| |    
25392727 ctatccttttattccaagctcttagagcttgctttaatccatagagggctttccataatttatactctttagatttctgattttttttacttcaaatcgt 25392628  T
204 agaggctgtgtcacaaaaac 223  Q
    ||||||||||||||||||||    
25392627 agaggctgtgtcacaaaaac 25392608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 10296 times since January 2019
Visitors: 7975