View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1681_low_44 (Length: 250)
Name: NF1681_low_44
Description: NF1681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1681_low_44 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 20 - 236
Target Start/End: Complemental strand, 4503627 - 4503411
Alignment:
| Q |
20 |
tattccagtaatgatacaacctgggttctctcaaaagattgttctttaattgaagttcattaatatcttgatctcaatcttagttgtaggtgtgaattca |
119 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4503627 |
tattccagtaatgatacaacttgggttctctcaaaagattgttctttaattgaatttcattaatatcttgatctcaatcttagttgtaggtgtgaattca |
4503528 |
T |
|
| Q |
120 |
cttagctcacaaaacctaagataaatttaggtcaatcaatttgtgagtaactttataactatttaattcacgaatacatataaagtttgaaggggttatc |
219 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4503527 |
cttagctcataaaacctaagataaatttaggtcaatcaatatgtgagttactttataactatttaattcacgaatacatataaagtttgaaggggttatc |
4503428 |
T |
|
| Q |
220 |
taatatagacccggtcc |
236 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
4503427 |
taatatagacccggtcc |
4503411 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 9332 times since January 2019
Visitors: 7893