View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1681_low_45 (Length: 249)
Name: NF1681_low_45
Description: NF1681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1681_low_45 |
| |
|
Alignment Details
Target: chr6 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 12 - 243
Target Start/End: Original strand, 7328718 - 7328949
Alignment:
Q |
12 |
atattgttattgttattgttattgcattcaataaatttatctttttaatgatttcaatcaccaattaaataatttaatttcaatccctactgctcaaatg |
111 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
7328718 |
atattgttattgttattgttattgcattcaataaatttatctttttaatgattccaatcaccaattaaataatttaatttcaatccctactgctcaaatg |
7328817 |
T |
|
Q |
112 |
catagactaatctctcaatctaggtaggagctctaaagattgcaatgttcgatttaacattgttggaatagaactcagaatctttggataagagggaaga |
211 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
T |
7328818 |
catagactaatctctcaatctaggtaggagctctaaagattgcaatgttcgatttaacattgttggaatagaactcggaatctttggataagagggaaga |
7328917 |
T |
|
Q |
212 |
tgtctcttattatctcattcaagtattatcta |
243 |
Q |
|
|
||||||||||||||||||||||| ||||||| |
|
|
T |
7328918 |
ggtctcttattatctcattcaagtgttatcta |
7328949 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 7902 times since January 2019
Visitors: 7737