View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1681_low_54 (Length: 238)
Name: NF1681_low_54
Description: NF1681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1681_low_54 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 36 - 238
Target Start/End: Complemental strand, 4504302 - 4504099
Alignment:
| Q |
36 |
taaagaaaagttgcaactaagggaagagactctactgaatggaatctctaaagacattatctgaaaa-ttgaccaattaactgcttgtgttgtggggcca |
134 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||| |
|
|
| T |
4504302 |
taaagaaaagttgcaactaagggaagagactctactgaatggaatctctaaagacattatctgaaaaattgaccaattaactgcttgtgttatggggcca |
4504203 |
T |
|
| Q |
135 |
taagggtaactaacatacacatgacaatacattatgttccaacaaaaatggtcccatgaacattagccctagctcagatctcgtgattaatctctctcac |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
4504202 |
taagggtaactaacatacacatgacaatacattatggtccaacaaaaatggtcccatgaacataagccctagctcagatctcgtgattaatctctctcac |
4504103 |
T |
|
| Q |
235 |
tttt |
238 |
Q |
| |
|
|||| |
|
|
| T |
4504102 |
tttt |
4504099 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 14045 times since January 2019
Visitors: 8375