View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1681_low_55 (Length: 237)

Name: NF1681_low_55
Description: NF1681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1681_low_55
NF1681_low_55
[»] chr4 (3 HSPs)
chr4 (24-169)||(34135952-34136097)
chr4 (179-237)||(34136079-34136136)
chr4 (69-114)||(34138959-34139004)


Alignment Details
Target: chr4 (Bit Score: 138; Significance: 3e-72; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 24 - 169
Target Start/End: Original strand, 34135952 - 34136097
Alignment:
24 aaaccagataccaagtatgtgaccgtggtttagctttgctgacaggttgaaaatgttgaaatactttataatcaacaagaatctcaacaaaccaaaatat 123  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
34135952 aaaccagataccaagtatgtgaccgtggtttagctttgctgacaggttgaaaatgttgaaatactttataatcaacaagaatctcaccaaaccaaaatat 34136051  T
124 attagcaaccagaaacgttaaaaacgaaatttgaaggcctatatca 169  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||    
34136052 attagcaaccagaaacgttaaaaactaaatttgaaggcctatatca 34136097  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 179 - 237
Target Start/End: Original strand, 34136079 - 34136136
Alignment:
179 aattcgaaagcctatatcaattcaatatttgaagatcaaacataatgaacggtaataac 237  Q
    |||| ||| ||||||||||||||||||||||| ||||||||||||||||||||||||||    
34136079 aatttgaaggcctatatcaattcaatatttga-gatcaaacataatgaacggtaataac 34136136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 69 - 114
Target Start/End: Original strand, 34138959 - 34139004
Alignment:
69 gttgaaaatgttgaaatactttataatcaacaagaatctcaacaaa 114  Q
    |||| ||||||||||||||||||||| |||||||||||||| ||||    
34138959 gttgtaaatgttgaaatactttataaacaacaagaatctcaccaaa 34139004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 8276 times since January 2019
Visitors: 7801