View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1681_low_58 (Length: 236)
Name: NF1681_low_58
Description: NF1681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1681_low_58 |
| |
|
Alignment Details
Target: chr3 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 29209968 - 29210183
Alignment:
Q |
1 |
atgtcttcattaaaagtgcattttttatgttctcttttaatttcattcaacttttcttacattttaatctcaatacggttaaaacttattatgcaaatgt |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
T |
29209968 |
atgtcttcattaaaagtgcattttttatgttctcttttaatttcattcaacttttcttacattttaatctcaatacggttaaaacttat---gcaaatgt |
29210064 |
T |
|
Q |
101 |
ttatctattatttaatttacatttatatataacacatttgaagatgcactttcattaccacagaatgtgtacagtagcagaatannnnnnnaattgaaaa |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||| |
|
|
T |
29210065 |
ttatctattatttaatttacatttatatataacacatttgaagatgcactttcattaccacagaatttgtacagtagcagaatatttttttaattgaaaa |
29210164 |
T |
|
Q |
201 |
caagaatgaccaaaaggtt |
219 |
Q |
|
|
||||||||||||||||||| |
|
|
T |
29210165 |
caagaatgaccaaaaggtt |
29210183 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 15918 times since January 2019
Visitors: 3757