View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1681_low_61 (Length: 234)
Name: NF1681_low_61
Description: NF1681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1681_low_61 |
| |
|
Alignment Details
Target: chr8 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 1 - 218
Target Start/End: Original strand, 3388592 - 3388808
Alignment:
Q |
1 |
tatttgcttacaattatcgagttagtagttaactaaagagagaaaagagggttagtggataagatcaagtcaatattatggagaaaataatgtannnnnn |
100 |
Q |
|
|
||||| ||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||| |
|
|
T |
3388592 |
tattttctttcaattatcgagtgagtagttaactaaagagagaaaagagggttagtggataagatcaagtcaatattacggagaaaataacgtatttttt |
3388691 |
T |
|
Q |
101 |
nccaataaaaacatgttttcatatttatcccgtataattatcagacaatatatttaaaacttttaaaatatgctctgtttacaacacattacacacaaaa |
200 |
Q |
|
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3388692 |
-ccaataaaaacatcttttcatatttatcccgtataattatcagacaatatatttaaaacttttaaaatatgctctgtttacaacacattacacacaaaa |
3388790 |
T |
|
Q |
201 |
actttgaagcttttggag |
218 |
Q |
|
|
|||||||||||||||||| |
|
|
T |
3388791 |
actttgaagcttttggag |
3388808 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 13240 times since January 2019
Visitors: 8270