View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1681_low_67 (Length: 230)
Name: NF1681_low_67
Description: NF1681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1681_low_67 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 30896366 - 30896146
Alignment:
| Q |
1 |
aattgacactgaatgtttcttaaacgtaagaagaaacaaatttggttcatctaattggtctctaactcaatgcactacctaggtacttagatccacctta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
30896366 |
aattgacactgaatgtttcttaaacgtaagaagaaacaaatttggttcatctaattggtctctaactcaatgcactacctaggtacttagatccaccaca |
30896267 |
T |
|
| Q |
101 |
tatttgatttattttattttggttgaaagctgaaaatcttctccatatatataaacaatttttagttcaagttttaaatcgaacttgtttacattatttg |
200 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
30896266 |
tatttgattcattttattttgtttgaaagctgaaaatcttctccatatatataaataatttttagttcaagttttaaatcgaactt-tttacattatttg |
30896168 |
T |
|
| Q |
201 |
gagacaaactatggaaggacaa |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
30896167 |
gagacaaactatggaaggacaa |
30896146 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 11946 times since January 2019
Visitors: 8179