View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1681_low_70 (Length: 228)
Name: NF1681_low_70
Description: NF1681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1681_low_70 |
| |
|
Alignment Details
Target: chr6 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 62 - 212
Target Start/End: Complemental strand, 7328478 - 7328328
Alignment:
Q |
62 |
gtttgccaactattttaactgcatttattatggatctaaaaagagagaattgatacttcatcaattgattatgagatatttctgggctgctacactaatt |
161 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
7328478 |
gtttgccaactattttaactgcatttattatggatctaaaaagagagaattgatacttcatcaattgattatgagatatttctgggctgctacactaatt |
7328379 |
T |
|
Q |
162 |
aattgctaccattaatccaatcaattgaaacttcaatacacacttatgttg |
212 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
7328378 |
aattgctaccattaatccaatcaattgaaacttcaatacacacttatgttg |
7328328 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 8379 times since January 2019
Visitors: 7802