View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1681_low_73 (Length: 222)
Name: NF1681_low_73
Description: NF1681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1681_low_73 |
| |
|
Alignment Details
Target: chr4 (Bit Score: 75; Significance: 1e-34; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 62 - 206
Target Start/End: Original strand, 24982822 - 24982967
Alignment:
Q |
62 |
ttagccaatccaacgtgccacataaggcgttgctgcatgagggtttaaaatcaaagaatcttgaaattataaagggaaa-cttcnnnnnnnnnttttaca |
160 |
Q |
|
|
|||| ||| ||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| | ||| || ||||||| |
|
|
T |
24982822 |
ttagtcaacccagcgtgccacataaggcgttgctgcatgagggtttaaaatcgaagaatcttgaaattataaaagaaaacctaaaaaaatatattttaca |
24982921 |
T |
|
Q |
161 |
agggataaaccaaaacttgttcaaatgacaggggtaaccatatatt |
206 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
24982922 |
ggggataaaccaaaacttgttcaaatgacaggggtaaccatatatt |
24982967 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 93 - 130
Target Start/End: Complemental strand, 25387707 - 25387670
Alignment:
Q |
93 |
gctgcatgagggtttaaaatcaaagaatcttgaaatta |
130 |
Q |
|
|
||||||||| ||| |||||||||||||||||||||||| |
|
|
T |
25387707 |
gctgcatgaaggtctaaaatcaaagaatcttgaaatta |
25387670 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 9043 times since January 2019
Visitors: 7893