View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1681_low_73 (Length: 222)

Name: NF1681_low_73
Description: NF1681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1681_low_73
NF1681_low_73
[»] chr4 (1 HSPs)
chr4 (62-206)||(24982822-24982967)
[»] chr3 (1 HSPs)
chr3 (93-130)||(25387670-25387707)


Alignment Details
Target: chr4 (Bit Score: 75; Significance: 1e-34; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 62 - 206
Target Start/End: Original strand, 24982822 - 24982967
Alignment:
62 ttagccaatccaacgtgccacataaggcgttgctgcatgagggtttaaaatcaaagaatcttgaaattataaagggaaa-cttcnnnnnnnnnttttaca 160  Q
    |||| ||| ||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| | ||| ||           |||||||    
24982822 ttagtcaacccagcgtgccacataaggcgttgctgcatgagggtttaaaatcgaagaatcttgaaattataaaagaaaacctaaaaaaatatattttaca 24982921  T
161 agggataaaccaaaacttgttcaaatgacaggggtaaccatatatt 206  Q
     |||||||||||||||||||||||||||||||||||||||||||||    
24982922 ggggataaaccaaaacttgttcaaatgacaggggtaaccatatatt 24982967  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 93 - 130
Target Start/End: Complemental strand, 25387707 - 25387670
Alignment:
93 gctgcatgagggtttaaaatcaaagaatcttgaaatta 130  Q
    ||||||||| ||| ||||||||||||||||||||||||    
25387707 gctgcatgaaggtctaaaatcaaagaatcttgaaatta 25387670  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 9043 times since January 2019
Visitors: 7893