View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1681_low_76 (Length: 211)
Name: NF1681_low_76
Description: NF1681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1681_low_76 |
| |
|
Alignment Details
Target: chr1 (Bit Score: 91; Significance: 3e-44; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 76 - 195
Target Start/End: Original strand, 29316881 - 29316999
Alignment:
Q |
76 |
ttttaccaagtttatattgttaaaatcactttaatttctccnnnnnnnntgaatgtacccataaacttttatagtatcaaataatgggagaaaataactc |
175 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
29316881 |
ttttaccaagtttatattgttaaaatcactttaatttctccaaaaaaa-tgaatgtacccataaacttttatagtatcaaataatgggagaaaataactc |
29316979 |
T |
|
Q |
176 |
acctggaggatcacaaaaca |
195 |
Q |
|
|
|||||||||||||||||||| |
|
|
T |
29316980 |
acctggaggatcacaaaaca |
29316999 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 10903 times since January 2019
Visitors: 8059