View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1681_low_76 (Length: 211)

Name: NF1681_low_76
Description: NF1681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1681_low_76
NF1681_low_76
[»] chr1 (1 HSPs)
chr1 (76-195)||(29316881-29316999)


Alignment Details
Target: chr1 (Bit Score: 91; Significance: 3e-44; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 76 - 195
Target Start/End: Original strand, 29316881 - 29316999
Alignment:
76 ttttaccaagtttatattgttaaaatcactttaatttctccnnnnnnnntgaatgtacccataaacttttatagtatcaaataatgggagaaaataactc 175  Q
    |||||||||||||||||||||||||||||||||||||||||        |||||||||||||||||||||||||||||||||||||||||||||||||||    
29316881 ttttaccaagtttatattgttaaaatcactttaatttctccaaaaaaa-tgaatgtacccataaacttttatagtatcaaataatgggagaaaataactc 29316979  T
176 acctggaggatcacaaaaca 195  Q
    ||||||||||||||||||||    
29316980 acctggaggatcacaaaaca 29316999  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 10903 times since January 2019
Visitors: 8059