View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1681_low_83 (Length: 201)
Name: NF1681_low_83
Description: NF1681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1681_low_83 |
| |
|
Alignment Details
Target: chr7 (Bit Score: 133; Significance: 2e-69; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 133; E-Value: 2e-69
Query Start/End: Original strand, 1 - 192
Target Start/End: Complemental strand, 30896289 - 30896098
Alignment:
Q |
1 |
cctaggtacttagatccaccttatatttgatttattttattttggttgaaagctgaaaatcttctccatatatataaacaatttttagttcaagttttaa |
100 |
Q |
|
|
|||||||||||||||||||| |||||||||| ||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
30896289 |
cctaggtacttagatccaccacatatttgattcattttattttgtttgaaagctgaaaatcttctccatatatataaataatttttagttcaagttttaa |
30896190 |
T |
|
Q |
101 |
atcgaacttgtttacattatttggagacaaactatggaaggacaa-nnnnnnnngttttaagtagaacgaagatgaggtacatggagtataat |
192 |
Q |
|
|
||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
T |
30896189 |
atcgaactt-tttacattatttggagacaaactatggaaggacaatttttttttgttttaagtagaacgaagatgaggtacatggagtataat |
30896098 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 16220 times since January 2019
Visitors: 3768