View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1711-Insertion-15 (Length: 654)
Name: NF1711-Insertion-15
Description: NF1711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1711-Insertion-15 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 98; Significance: 6e-48; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 98; E-Value: 6e-48
Query Start/End: Original strand, 8 - 117
Target Start/End: Original strand, 27245291 - 27245399
Alignment:
| Q |
8 |
tattggttgtctagattttgggttcattcaatcatagtgatcaattatttttgattggcttgcaggtggaaaatatggaaaaggagttggaatcattcat |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27245291 |
tattggttgtctagattttgggttcattcaatcatagtgaacaattatttt-gattggcttgcaggtggaaaatatggaaaaggagttggaatcattcat |
27245389 |
T |
|
| Q |
108 |
gcaatcttcc |
117 |
Q |
| |
|
|||||||||| |
|
|
| T |
27245390 |
gcaatcttcc |
27245399 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 51; E-Value: 7e-20
Query Start/End: Original strand, 115 - 169
Target Start/End: Original strand, 27245424 - 27245478
Alignment:
| Q |
115 |
tcccctacagaatctaaagataaaaaatagagaaagaaaccactttcgggaccat |
169 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
27245424 |
tcccctacagaatctaaagataaaaaatagagaaagaaaccactttccggaccat |
27245478 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 7838 times since January 2019
Visitors: 7737