View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1711-Insertion-16 (Length: 132)
Name: NF1711-Insertion-16
Description: NF1711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1711-Insertion-16 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 113; Significance: 1e-57; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 113; E-Value: 1e-57
Query Start/End: Original strand, 7 - 132
Target Start/End: Complemental strand, 163117 - 162990
Alignment:
| Q |
7 |
atagcttactatgagttccgtgaagtcttacacacaagactcaaaagcaaacaataccgcagaaatgtggcttgaggtcgaaacac--tgtatagaatat |
104 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
163117 |
atagcttactataagttccgtgaagtcttacacacaagactcaaaagcaaacaataccgcagaaatgtggcttgaggtcgaaacactgtgtatagaatat |
163018 |
T |
|
| Q |
105 |
agagtaacagttctttacagttaactag |
132 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
163017 |
agagtaacagttctttacagttaactag |
162990 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 13364 times since January 2019
Visitors: 8302