View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1711-Insertion-2 (Length: 238)
Name: NF1711-Insertion-2
Description: NF1711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1711-Insertion-2 |
 | |
|
| [»] scaffold0085 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0085 (Bit Score: 231; Significance: 1e-128; HSPs: 1)
Name: scaffold0085
Description:
Target: scaffold0085; HSP #1
Raw Score: 231; E-Value: 1e-128
Query Start/End: Original strand, 8 - 238
Target Start/End: Complemental strand, 45403 - 45173
Alignment:
| Q |
8 |
atatcaaggtttttgatgtctttatgatcgcatagaagtatatttaacaattattctctgtaatatcgtggattatgtcgtgatcgcaatttaaaacttt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45403 |
atatcaaggtttttgatgtctttatgatcgcatagaagtatatttaacaattattctctgtaatatcgtggattatgtcgtgatcgcaatttaaaacttt |
45304 |
T |
|
| Q |
108 |
gcgcacggagaattgcttgaaaatttggtttttggatgatgcagaccaattcaaattgcacaaattcttcattctcagggacggaatcatgtcggcactt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45303 |
gcgcacggagaattgcttgaaaatttggtttttggatgatgcagaccaattcaaattgcacaaattcttcattctcagggacggaatcatgtcggcactt |
45204 |
T |
|
| Q |
208 |
gtgcaggcccgtgcccccactttgtttctga |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
45203 |
gtgcaggcccgtgcccccactttgtttctga |
45173 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 11677 times since January 2019
Visitors: 8091