View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1711-Insertion-3 (Length: 278)
Name: NF1711-Insertion-3
Description: NF1711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1711-Insertion-3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 7 - 242
Target Start/End: Original strand, 2844025 - 2844263
Alignment:
| Q |
7 |
acctagttatagaaaacaaaacgtgggtaaagcatatgatgccaacgaaagtatatgagtttgccactttcctatgtttggctggatcttagcagaagcc |
106 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
2844025 |
acctagttatagaaaacaaaacgtgggtagagcatatgatgccaacgaaagtatatgagtttgccagtttcatatgtttggctggatcttagcagaagcc |
2844124 |
T |
|
| Q |
107 |
aaagtcggtttcctaatattaaggtttgtttcagaatctcaagctgacacact---tcactctatcattctcacacatatataccacccatcttttcact |
203 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2844125 |
aaagtcggtttcctaaaattaaggtttgtttcagaatctcaagctgacacacttcatcactctatcattctcacacatatataccacccatcttttcact |
2844224 |
T |
|
| Q |
204 |
ctttcttcatatccatcaaattctcttgttttctttttt |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2844225 |
ctttcttcatatccatcaaattctcttgttttctttttt |
2844263 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 13950 times since January 2019
Visitors: 8375