View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1711_high_104 (Length: 201)
Name: NF1711_high_104
Description: NF1711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1711_high_104 |
| |
|
Alignment Details
Target: chr4 (Bit Score: 135; Significance: 1e-70; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 135; E-Value: 1e-70
Query Start/End: Original strand, 43 - 184
Target Start/End: Original strand, 41272905 - 41273047
Alignment:
Q |
43 |
aaaatagatcctcaagtacctgaacggatctaaagtctaaactcagtctggagttggaatcacatgatgaagcaaggaagaaaaaactgtgttgattta- |
141 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
41272905 |
aaaatagatcctcaagtacctgaacggatctaaagtctaaactcagtctggagttggaatcacatgatgaagcaaggaagaaaaaactgtgttgatttat |
41273004 |
T |
|
Q |
142 |
ttcattggttgtgacatgtgggagaaacctaatttccaagcat |
184 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
41273005 |
ttcattggttgtgacatgtgggagaaacctaatttccaagcat |
41273047 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 9810 times since January 2019
Visitors: 7932