View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1711_high_45 (Length: 311)
Name: NF1711_high_45
Description: NF1711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1711_high_45 |
| |
|
Alignment Details
Target: chr7 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 18 - 303
Target Start/End: Original strand, 21483756 - 21484041
Alignment:
Q |
18 |
tgaggaacaatatttgaaggtattattgtgttcgtgttggcgttttctttgagtcttttgttgtgaagatgactagtttgaacccattcaagaatgagct |
117 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
T |
21483756 |
tgaggaacaatatttgaaggtattattgtgttcgtgttggcgttttctttgagtcttttgttatgaagatgactagtttgaacccattcaagaatgagct |
21483855 |
T |
|
Q |
118 |
tcaacaattgtttcatcccttcttttccaccacctaatctcctagcagcactttcgatcgtcgatttcttaagcttcacattcctcaaatcattcgcgga |
217 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
21483856 |
tcaacaattgtttcatcccttcttttccaccacctaatctcctagcagcactttcaatcgttgatttcttaagcttcacattcctcaaatcattcgcgga |
21483955 |
T |
|
Q |
218 |
gacactgtctttgttcgatttaagccactccaagaaaaccatactcatttcatcacttacaccatcacatgcacctaattcatctc |
303 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
21483956 |
gacactgtctttgttcgatttaagccactccaagaaaaccatactcatttcatcacttacaccatcacatgcacctaattcatctc |
21484041 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 13949 times since January 2019
Visitors: 8375