View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1711_high_63 (Length: 268)
Name: NF1711_high_63
Description: NF1711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1711_high_63 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 45 - 268
Target Start/End: Original strand, 13341275 - 13341497
Alignment:
| Q |
45 |
acatcagtgtcgacagacaatatattaaattcttcccttctcagaaggattctccaataagatgcagtagctttagacacatgcct-ataaggattctcc |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
13341275 |
acatcagtgtcgacagacaatatattaaattcttccctaatcacaaggattctccaataagatgcagtagctttagacacatgccttataaggattctcc |
13341374 |
T |
|
| Q |
144 |
aatccaaatggagtcattccatgataaggttccatagttgagttctccatcagaggaatctccatgtgaggaatttctataggagcttgaaatgtaggca |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13341375 |
aatccaaatggagtcattccatgataaggttccatag--gagttctccatcagaggaatctccatgtgaggaatttctataggagcttgaaatgtaggca |
13341472 |
T |
|
| Q |
244 |
aggttgtcaaaatcgggattttgct |
268 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
13341473 |
aggttgtcaaaatcgggattttgct |
13341497 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 239 - 268
Target Start/End: Complemental strand, 8889574 - 8889545
Alignment:
| Q |
239 |
aggcaaggttgtcaaaatcgggattttgct |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
8889574 |
aggcaaggttgtcaaaatcgggattttgct |
8889545 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 8308 times since January 2019
Visitors: 7802