View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1711_high_74 (Length: 248)
Name: NF1711_high_74
Description: NF1711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1711_high_74 |
| |
|
Alignment Details
Target: chr8 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 43862317 - 43862551
Alignment:
Q |
1 |
cctttaatccacatgcagctgcttacaagattttaatttgtttggcatgttagattagttatctatgataacaaaattttatggaattataactttgttt |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43862317 |
cctttaatccacatgcagctgcttacaagattttaatttgtttggcatgttagattagttatctatgataacaaaattttatggaattataactttgttt |
43862416 |
T |
|
Q |
101 |
aactttttcatggtcttcgagaaattttagnnnnnnnnnnaatatttttaaatataataaaaaatagctggacttgcgtgtgatgaaattctatgaaaat |
200 |
Q |
|
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43862417 |
aactttttcatggtcttcgagaaattttagttttttttttaatatttttaaatataataaaaaatagctggacttgcgtgtgatgaaattctatgaaaat |
43862516 |
T |
|
Q |
201 |
tgtccgtctttgtatatatatgctttcattttgtctgtg |
239 |
Q |
|
|
|||||||||||| |||||||||||||||||| |||| |
|
|
T |
43862517 |
tgtccgtctttg----tatatgctttcattttgtgtgtg |
43862551 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 8677 times since January 2019
Visitors: 7803